IthaID: 3738
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | IVS II-141 T>C | HGVS Name: | HBA1:c.301-9T>C |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGGGCGAGATGGCGCCTTCCTCGCA [G/A] GGCAGAGGATCACGCGGGTTGCGGG (Strand: +)
Also known as:
Comments: Found in a 17-year old Indian individual presented with Hb 10.7 g/dL, MCV 68.5 fL, MCH 21.8 pg, RBC 4.92 10^12/L, HbA1/HbE 2.2 % and normal level of HbF and HbA. Co-inheritance of the IVS II-141 T>C with CAP +1 (A>C) [IthaID: 34] reported in a 2nd case, in a 79-year old Malay male in compound heterozygosity presented with Hb 12.6 g/dL, MCV 85 fL, MCH 29.4 pg, RBC 4.28 10^12/L and borderline HbA2 level.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38137 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Indian, Malay |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |
Created on 2021-02-12 14:22:52,
Last reviewed on 2021-05-14 15:43:44 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.