IthaID: 3731
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | IVS II-34 G>A | HGVS Name: | HBA2:c.300+34G>A |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGCCGGGAGCGATCTGGGTCGAG [G/A] GGCGAGATGGCGCCTTCCTCTCAG (Strand: +)
Also known as:
Comments: Reported in five unrelated cases. In 1st case, the IVS II-34 G>A found in compound heterozygosity (cis/trans) with Hb Georgia [IthaID: 3718], in a 17-year old individual presented with reduced level of Hb 11 g/dL, MCV 74 fL and MCH 23.7 pg, normal HbA2 2.4 % but elevated level of HbF 10.6 %. The remaining four cases were asymptomatic with Hb range 9.5-13.3 g/dL, MCV 55.9-87.4 fL, MCH 18.1-29.5 pg, RBC 4.5-7 10^12/L and HbA2 1.6-3.2 %, without abnormal peak. One of these cases has co-inheritance with underlying iron deficiency anemia presented with reduced level of Hb 9.5 g/dL, MCV 18.1 fL, MCV 62 pg and HbA2 1.6 %.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34226 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Malay |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |