IthaID: 3727
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | Cap +23 C>G | HGVS Name: | HBA2:c.-15C>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCGGCACTCTTCTGGTCCCCACAGACT [C/G] AGAGAACCCACCATGGTGCTGTCTCCT (Strand: +)
Comments: Found in one Malay case presented with Hb 11.5 g/dL, MCV 71.6 fL, MCH 21.7 pg and RBC 5.29 10^12/L. Hb analysis was normal with no abnormal peak.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33761 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Malay |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Mohd Yasin, Norafiza | 2020-11-24 | First report. |
Created on 2021-02-09 08:48:01,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.