IthaID: 3721


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 14 CTG>-TG HGVS Name: HBB:c.43delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGGAGAAGTCTGCCGTTACTGCC [T/-] AGGAGAAGTCTGCCGTTACTGCC (Strand: -)

Protein sequence:
MVHLTPEEKSAVTACGARX

Also known as:

Comments: Found in two in a 1-year old girl with significantly reduced MCV 63.4 fL and MCH 18.2 pg. The mutation was inherited from her 27-year old father, who was also associated with significantly reduced MCV 63.4 fL, MCH 18.2 pg and Hb 11.5 g/dL. The T deletion, causing a frameshift that introduces a premature stop codon four amino acids further down the new reading frame.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70637
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Zhang H, Li C, Li J, Hou S, Chen D, Yan H, Chen S, Liu S, Yin Z, Yang X, Tan J, Huang X, Zhang L, Fang J, Zhang C, Li W, Guo J, Lei D, Next-generation sequencing improves molecular epidemiological characterization of thalassemia in Chenzhou Region, P.R. China., J Clin Lab Anal, 33(4), e22845, 2019
Created on 2021-01-30 14:57:41, Last reviewed on 2021-02-01 12:30:52 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.