IthaID: 371

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 39 (-ACC) [-Thr] HGVS Name: HBA1:c.118_120del
Hb Name: Hb Taybe Protein Info: α1 39(C4) Thr->0
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAGGATGTTCCTGTCCTTCCCCACC [ACC/-] AAGACCTACTTCCCGCACTTCGACC (Strand: +)

Comments: This deletion results in a structural abnormality that affects the α1β2 contact and the α1β1 interface, producing a highly unstable Hb. Moderate to severe haemolytic anaemia in the homozygote or compound heterozygote state. Normal clinical phenotype in the heterozygote state.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37814
Size: 3 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Arabian, Israeli
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Pobedimskaya DD, Molchanova TP, Streichman S, Huisman TH, Compound heterozygosity for two alpha-globin gene defects, Hb Taybe (alpha 1; 38 or 39 minus Thr) and a poly A mutation (alpha 2; AATAAA-->AATAAG), results in a severe hemolytic anemia., American journal of hematology, 47(3), 198-202, 1994
  2. Galacteros F, Girodon E, M'Rad A, Martin J, Goossens M, Jaber L, Cohen IJ, Tamary H, Goshen Y, Zaizov R, Hb Taybe (alpha 38 or 39 THR deleted): an alpha-globin defect, silent in the heterozygous state and producing severe hemolytic anemia in the homozygous., C. R. Acad. Sci. III, Sci. Vie , 317(5), 437-44, 1994
  3. Ben-Bassat I, Simjanovska L, Jaber L, Efremov GD, HB Taybe: description of genetics and laboratory findings in an Israeli Arab family., Hemoglobin , 22(2), 161-6, 1998
  4. Juul MB, Vestergaard H, Petersen J, Frederiksen H, Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)]., Hemoglobin , 36(6), 600-4, 2012
  5. Hill QA, Farrar L, Lordan J, Gallienne A, Henderson S, A combination of two novel alpha globin variants Hb Bridlington (HBA1) and Hb Taybe (HBA2) resulting in severe hemolysis, pulmonary hypertension, and death., Hematology , 20(1), 50-2, 2015
  6. Koren A, Levin C, Zalman L, Palmor H, Filon D, Chubar E, Resnitzky P, Bennett M, Hb TAYBE: clinical and morphological findings IN 43 patients., Eur. J. Haematol. , 97(2), 137-44, 2016
Created on 2010-06-16 16:13:15, Last reviewed on 2021-04-02 09:46:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.