IthaID: 371
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 39 (-ACC) [-Thr] | HGVS Name: | HBA1:c.118_120del |
| Hb Name: | Hb Taybe | Protein Info: | α1 39(C4) Thr->0 |
Context nucleotide sequence:
CAGGATGTTCCTGTCCTTCCCCACC [ACC/-] AAGACCTACTTCCCGCACTTCGACC (Strand: +)
Also known as:
Comments: This deletion results in a structural abnormality that affects the α1β2 contact and the α1β1 interface, producing a highly unstable Hb. Moderate to severe haemolytic anaemia in the homozygote or compound heterozygote state. Normal clinical phenotype in the heterozygote state.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | α⁺ |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37814 |
| Size: | 3 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Arabian, Israeli |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Pobedimskaya DD, Molchanova TP, Streichman S, Huisman TH, Compound heterozygosity for two alpha-globin gene defects, Hb Taybe (alpha 1; 38 or 39 minus Thr) and a poly A mutation (alpha 2; AATAAA-->AATAAG), results in a severe hemolytic anemia., American journal of hematology, 47(3), 198-202, 1994
- Galacteros F, Girodon E, M'Rad A, Martin J, Goossens M, Jaber L, Cohen IJ, Tamary H, Goshen Y, Zaizov R, Hb Taybe (alpha 38 or 39 THR deleted): an alpha-globin defect, silent in the heterozygous state and producing severe hemolytic anemia in the homozygous., C. R. Acad. Sci. III, Sci. Vie , 317(5), 437-44, 1994
- Ben-Bassat I, Simjanovska L, Jaber L, Efremov GD, HB Taybe: description of genetics and laboratory findings in an Israeli Arab family., Hemoglobin , 22(2), 161-6, 1998
- Juul MB, Vestergaard H, Petersen J, Frederiksen H, Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)]., Hemoglobin , 36(6), 600-4, 2012
- Hill QA, Farrar L, Lordan J, Gallienne A, Henderson S, A combination of two novel alpha globin variants Hb Bridlington (HBA1) and Hb Taybe (HBA2) resulting in severe hemolysis, pulmonary hypertension, and death., Hematology , 20(1), 50-2, 2015
- Koren A, Levin C, Zalman L, Palmor H, Filon D, Chubar E, Resnitzky P, Bennett M, Hb TAYBE: clinical and morphological findings IN 43 patients., Eur. J. Haematol. , 97(2), 137-44, 2016
Created on 2010-06-16 16:13:15,
Last reviewed on 2021-04-02 09:46:16 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.