IthaID: 3709
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs75853687 | HGVS Name: | NC_000005.10:g.159850278G>A |
Context nucleotide sequence:
GGGTTTCAGGGCTTGGGCAAGC [G>A] TGAGTGATTCGCACTCTGGCAGG (Strand: +)
Also known as:
Comments: Allele 'A' associated with an increased susceptibility to develop alloantibodies in transfused sickle cell disease (SCD) patients of African ancestry. Nominally replicated in an independent cohort of SCD transfusion recipients. Located in an enhancer region embedded within the lncRNA gene LINC01847 and is near binding sites for multiple transcription factors and enhancer binding proteins, such as CEBPB (pro-inflammatory function).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Red blood cell alloimmunisation |
Location
| Chromosome: | 5 |
|---|---|
| Locus: | NR_109891.1 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | LINC01847 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Williams LM, Qi Z, Batai K, Hooker S, Hall NJ, Machado RF, Chen A, Campbell-Lee S, Guan Y, Kittles R, Hanchard NA, A locus on chromosome 5 shows African ancestry-limited association with alloimmunization in sickle cell disease., Blood Adv, 2(24), 3637-3647, 2018
Created on 2020-12-09 14:00:07,
Last reviewed on 2020-12-09 14:00:41 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.