IthaID: 3708


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs67088901 HGVS Name: NC_000002.12:g.15102159G>A

Context nucleotide sequence:
GCATCCTCTGTGTCCAGCCACAA [G>A] GGTCATCACCCAAGATGACCTGA (Strand: +)

Also known as:

Comments: Genic Downstream Transcript Variant (NM_015909.4:c.). Associated with red blood cell alloimmunization in transfused patients with sickle cell disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Red blood cell alloimmunisation

Location

Chromosome: 2
Locus: NG_032964.1
Locus Location: N/A
Size: 1 bp
Located at: NBAS
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Williams LM, Qi Z, Batai K, Hooker S, Hall NJ, Machado RF, Chen A, Campbell-Lee S, Guan Y, Kittles R, Hanchard NA, A locus on chromosome 5 shows African ancestry-limited association with alloimmunization in sickle cell disease., Blood Adv, 2(24), 3637-3647, 2018
Created on 2020-12-09 13:22:51, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.