IthaID: 3706


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1160065459 HGVS Name: NC_000019.10:g.10148923G>A

Context nucleotide sequence:
CTGTTGGCTGGGTTTTTGGAGGG [G>A] ACTCGAATCTCGCGTAGTCTTGA (Strand: +)

Also known as:

Comments: Associated with high HbF production by epigenetically de-repressing γ-globin expression and amelioration of disease severity in a Chinese cohort of β-thalassaemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 19
Locus: NG_028016.3
Locus Location: 87364
Size: 1 bp
Located at: DNMT1
Specific Location: Exon 27

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Gong Y, Zhang X, Zhang Q, Zhang Y, Ye Y, Yu W, Shao C, Yan T, Huang J, Zhong J, Wang L, Li Y, Wang L, Xu X, A natural DNMT1 mutation elevates the fetal hemoglobin via epigenetic de-repression of γ-globin gene in β-thalassemia., Blood, 2020
Created on 2020-12-01 13:20:29, Last reviewed on 2020-12-01 13:20:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.