
IthaID: 3701
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs9380142 | HGVS Name: | NG_029039.1:g.9039A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTTCTGTATTAAAATTAGAATCTGAGT [A>G] TAAATTTACTTTTTCAAATTATTTCCAA (Strand: +)
Comments: The 'G' allele associated with a higher risk of cholelithiasis in a cohort of sickle cell disease patients (mainly from sub-Saharan Africa).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Gallstones [HP:0001081] [OMIM:600803] |
Location
Chromosome: | 6 |
---|---|
Locus: | NG_029039.1 |
Locus Location: | 9039 |
Size: | 1 bp |
Located at: | HLA-G |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Tozatto-Maio K, Girot R, Ly ID, Silva Pinto AC, Rocha V, Fernandes F, Diagne I, Benzerara Y, Dinardo CL, Soler JP, Kashima S, Araujo IL, Kenzey C, Fonseca GHH, Rodrigues ES, Volt F, Jarduli L, Ruggeri A, Mariaselvam C, Gualandro SFM, Rafii H, Cappelli B, Nogueira FM, Scigliuolo GM, Guerino-Cunha RL, Malmegrim KCR, Simões BP, Gluckman E, Tamouza R, Polymorphisms in Inflammatory Genes Modulate Clinical Complications in Patients With Sickle Cell Disease., Front Immunol, 11(0), 2041, 2020
Created on 2020-11-16 16:38:04,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.