IthaID: 37
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CAP +20 C>T; IVS II-745 C>G | HGVS Name: | HBB:c.[-31C>T;316-106C>G] |
Context nucleotide sequence:
TTGCTTACATTTGCTTCTGACACAA [C/T] TGTGTTCACTAGCAACCTCAAACAG (Strand: -)
Also known as:
Comments: This mutation is an innocuous SNP associated with the IVSII-745 mutation in cis.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70564 or 71784 |
| Size: | 1 bp or 1 bp |
| Located at: | β |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Bulgarian, Iranian, Mediterranean |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Galehdari H, Salehi B, Pedram M, Oraki Kohshour M, High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran., Iran Red Crescent Med J, 13(5), 356-8, 2011
- Ropero P, González FA, Cela E, Beléndez C, Cervera A, Martínez-Nieto J, de la Fuente-Gonzalo F, Vinuesa L, Villegas A, Díaz-Mediavilla J, Association in cis of the mutations +20 (C>T) in the 5' untranslated region and IVS-II-745 (C>G) on the β-globin gene., Hemoglobin , 37(2), 112-8, 2013
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-09-29 12:13:41 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.