
IthaID: 37
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | CAP +20 C>T; IVS II-745 C>G | HGVS Name: | HBB:c.[-31C>T;316-106C>G] |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTGCTTACATTTGCTTCTGACACAA [C/T] TGTGTTCACTAGCAACCTCAAACAG (Strand: -)
Comments: The c.-31C>T variant in the 5'UTR of the HBB gene is considered an innocuous SNP associated in cis with IVS II-745 [IthaID: 214]. In two transfusion-dependent beta-thalassemia patients from Brazil, this in cis variant was co-inherited separately with IVS I-6 T>C [IthaID: 111] in one patient and with β0 CD39 [IthaID: 142] in the other. Homozygosity for the in cis variant was associated with thalassemia major or intermedia in a Turkish proband, as well as in two related Iranian individuals with a history of transfusion dependency from early infancy. It was also identified in three unrelated Spanish families, where heterozygous carriers exhibited a thalassemia trait phenotype, while compound heterozygotes with a β+ or β0 allele presented with thalassemia major.
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70564 or 71784 |
Size: | 1 bp or 1 bp |
Located at: | β |
Specific Location: | 5'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | 5'UTR (Transcription) |
Ethnic Origin: | Turkish, Iranian, Spanish |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Gonzalez-Redondo JM, Stoming TA, Kutlar A, Kutlar F, Lanclos KD, Howard EF, Fei YJ, Aksoy M, Altay C, Gurgey A, A C----T substitution at nt--101 in a conserved DNA sequence of the promotor region of the beta-globin gene is associated with , Blood , 73(6), 1705-11, 1989
- Yavarian M, Harteveld CL, Batelaan D, Bernini LF, Giordano PC, Molecular spectrum of beta-thalassemia in the Iranian Province of Hormozgan., Hemoglobin, 25(1), 35-43, 2001
- Galehdari H, Salehi B, Pedram M, Oraki Kohshour M, High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran., Iran Red Crescent Med J, 13(5), 356-8, 2011
- Ropero P, González FA, Cela E, Beléndez C, Cervera A, Martínez-Nieto J, de la Fuente-Gonzalo F, Vinuesa L, Villegas A, Díaz-Mediavilla J, Association in cis of the mutations +20 (C>T) in the 5' untranslated region and IVS-II-745 (C>G) on the β-globin gene., Hemoglobin , 37(2), 112-8, 2013