IthaID: 3697


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 147 TAA>ΑAA [Stop>Lys] HGVS Name: HBB:c.442T>A
Hb Name: Hb Mokum Protein Info: β 147, Stop>Lys; modified C-terminal sequence: (147)Lys-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH

Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCAC [T/A] AAGCTCGCTTTCTTGCTGTCCAATTT (Strand: -)

Also known as:

Comments: Reported as a de novo mutation in a patient with hemolytic anaemia, leading to dominant β-thalassaemia state. The mutation results in a stop-codon substitution to a lysine residue and an increase of 21 amino-acids in the β-globin chain.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72016
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Valeria Rizzuto, Tamara T Koopmann, Adoración Blanco-Álvarez, Barbara Tazón-Vega, Amira Idrizovic, Cristina Díaz de Heredia, Rafael Del Orbe, Miriam Vara Pampliega, Pablo Velasco, David Beneitez, Gijs W E Santen, Quinten Waisfisz, Mariet Elting, Frans J W Smiers, Anne J de Pagter, Jean-Louis H Kerkhoffs, Cornelis L Harteveld, Maria Del Mar Mañú-Pereira, doi: 10.3389/fphys.2021.628236. eCollection 2021. Usefulness of NGS for Diagnosis of Dominant Beta-Thalassemia and Unstable Hemoglobinopathies in Five Clinical Cases, Frontiers in Physiology, 12(0), 0, 2021

Microattributions

A/AContributor(s)DateComments
1L. Harteveld, Cornelis2020-11-11First report.
Created on 2020-11-11 11:41:12, Last reviewed on 2021-06-03 09:32:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.