IthaID: 3694


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 48 CTG>CAG [Leu>Gln] HGVS Name: HBA2:c.146T>A
Hb Name: Hb Ijselland Protein Info: N/A

Context nucleotide sequence:
CCCCACCACCAAGACCTACTTCCCGCACTTCGACC [T/A] GAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGC (Strand: +)

Also known as:

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34038
Size: 1 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1L. Harteveld, Cornelis2020-10-20First report.
Created on 2020-10-27 14:35:52, Last reviewed on 2020-10-29 08:31:11 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.