IthaID: 3692

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Variant of Uncertain Significance
Common Name:	CD 35 (TAC>TA-)	HGVS Name:	HBB:c.108delC
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG [C/-] AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGG (Strand: -)

Also known as:

Comments: Found in two Malay individuals presented with severe microcytosis (MCV: 63, 47.2 fL) and hypocromia (MCH: 19, 14.2 pg) and also with moderate anemia. Both patients showed elevated level of Hb A2 level (5.8, 5.1 %).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70832
Size:	1 bp
Located at:	β
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Malay
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/A	Contributor(s)	Date	Comments
1	Zilfalil, Bin Alwi	2020-10-20	First report.
2	Mohd Yasin, Norafiza	2020-10-20	First report.

Created on 2020-10-27 14:31:19, Last reviewed on (Show full history)

A/A	Date	Curator(s)	Comments
1	2020-10-27 14:31:19	The IthaGenes Curation Team	Created

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.