IthaID: 3686


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: IVS II-672 (A>C) HGVS Name: HBB:c.316-179A>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGC [A/C] TATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGG (Strand: +)

Also known as:

Comments: Found in two individuals, a Chinese female and a Malay male. The 71-year-old female presented with severe decreased levels of MCV (63 fL) and MCH (19.3 pg). The 27-year-old male presented with mild decreased levels of MCV (76.8 fL) and MCH (26.1 pg) but with elevated Hb A2 (3.8 %).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71711
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Malay, Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-10-20First report.
Created on 2020-10-27 14:13:51, Last reviewed on 2023-03-07 13:02:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.