IthaID: 3681


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: IVS II-63 (T>C) HGVS Name: HBB:c.315+63T>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TTCCCCTTCTTTTCTATGGTTAAGTTCATGTCA [T/C] GTAACAGGGTACAGTTTAGAATGGGAAACAGA (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71102
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-10-20First report.
Created on 2020-10-27 14:04:20, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.