IthaID: 3653

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs3892097	HGVS Name:	NG_008376.3:g.6047G>A

Context nucleotide sequence:
CCCCTTACCCGCATCTCCCACCCCCA [G>A] GACGCCCCTTTCGCCCCAACGGTCTC (Strand: -)

Also known as:

Comments: Associated with response to hydroxyurea treatment in patients with sickle cell anaemia based on observed alterations in laboratory biomarkers, including hemolytic, hepatic and lipid parameters.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Response to hydroxyurea

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	22
Locus:	NG_008376.3
Locus Location:	6047
Size:	1 bp
Located at:	CYP2D6
Specific Location:	Intron 3

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Splice junction (mRNA Processing)
Ethnic Origin:	Brazilian
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Yahouédéhou SCMA, Neres JSDS, da Guarda CC, Carvalho SP, Santiago RP, Figueiredo CVB, Fiuza LM, Ndidi US, de Oliveira RM, Fonseca CA, Nascimento VML, Rocha LC, Adanho CSA, da Rocha TSC, Adorno EV, Goncalves MS, Sickle Cell Anemia: Variants in the , , and Genes Are Associated With Improved Hydroxyurea Response., Front Pharmacol, 11(0), 553064, 2020

Created on 2020-10-13 12:29:41, Last reviewed on 2020-10-13 12:36:31 (Show full history)

A/A	Date	Curator(s)	Comments
1	2020-10-13 12:29:41	The IthaGenes Curation Team	Created
2	2020-10-13 12:36:31	The IthaGenes Curation Team	Reviewed. Comment added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.