IthaID: 3653
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs3892097 | HGVS Name: | NG_008376.3:g.6047G>A |
Context nucleotide sequence:
CCCCTTACCCGCATCTCCCACCCCCA [G>A] GACGCCCCTTTCGCCCCAACGGTCTC (Strand: -)
Also known as:
Comments: Associated with response to hydroxyurea treatment in patients with sickle cell anaemia based on observed alterations in laboratory biomarkers, including hemolytic, hepatic and lipid parameters.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Response to hydroxyurea |
Location
Chromosome: | 22 |
---|---|
Locus: | NG_008376.3 |
Locus Location: | 6047 |
Size: | 1 bp |
Located at: | CYP2D6 |
Specific Location: | Intron 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Splice junction (mRNA Processing) |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Yahouédéhou SCMA, Neres JSDS, da Guarda CC, Carvalho SP, Santiago RP, Figueiredo CVB, Fiuza LM, Ndidi US, de Oliveira RM, Fonseca CA, Nascimento VML, Rocha LC, Adanho CSA, da Rocha TSC, Adorno EV, Goncalves MS, Sickle Cell Anemia: Variants in the , , and Genes Are Associated With Improved Hydroxyurea Response., Front Pharmacol, 11(0), 553064, 2020
Created on 2020-10-13 12:29:41,
Last reviewed on 2020-10-13 12:36:31 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-10-13 12:29:41 | The IthaGenes Curation Team | Created |
2 | 2020-10-13 12:36:31 | The IthaGenes Curation Team | Reviewed. Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07