IthaID: 364


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-117 GCAGGA>GCAAGA acceptor HGVS Name: HBA1:c.96-1G>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ACCCCTCACTCTGCTTCTCCCCGCA [A/G] GATGTTCCTGTCCTTCCCCACCACC (Strand: +)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37791
Size: 1 bp
Located at: α1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Asian Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Frequencies

Publications / Origin

  1. Cürük MA, Baysal E, Gupta RB, Sharma S, Huisman TH, An IVS-I-117 (G-->A) acceptor splice site mutation in the alpha 1-globin gene is a nondeletional alpha-thalassaemia-2 determinant in an Indian population., British journal of haematology, 85(1), 148-52, 1993
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.