IthaID: 3635
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 26 GAG>GAA | HGVS Name: | HBB:c.81G>A |
Context nucleotide sequence:
AACGTGGATGAAGTTGGTGGTGA [G>A] GCCCTGGGCAGGTTGGTATCAAGG (Strand: -)
Also known as:
Comments: Reported as a neutral polymorphism; found in a homozygous state in a subject with beta-thalassaemia. No genotype information given.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70675 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Iranian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Jalilian M, Azizi Jalilian F, Ahmadi L, Amini R, Esfehani H, Sosanian M, Rabbani B, Maleki M, Mahdieh N, The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran., Hemoglobin, 41(1), 61-64, 2017
Created on 2020-09-28 16:36:49,
Last reviewed on 2020-09-28 17:01:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.