IthaID: 3635

Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: CD 26 GAG>GAA HGVS Name: HBB:c.81G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AACGTGGATGAAGTTGGTGGTGA [G>A] GCCCTGGGCAGGTTGGTATCAAGG (Strand: -)

Comments: Reported as a neutral polymorphism; found in a homozygous state in a subject with beta-thalassaemia. No genotype information given.

External Links

No available links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70675
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Jalilian M, Azizi Jalilian F, Ahmadi L, Amini R, Esfehani H, Sosanian M, Rabbani B, Maleki M, Mahdieh N, The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran., Hemoglobin, 41(1), 61-64, 2017
Created on 2020-09-28 16:36:49, Last reviewed on 2020-09-28 17:01:42 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.