IthaID: 363

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-116 GCAGGA>GCGGGA acceptor HGVS Name: HBA2:c.96-2A>G
Hb Name: N/A Protein Info: α2 nt 248 A>G
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACCCCTCACTCTGCTTCTCCCCGC [A/G] GGATGTTCCTGTCCTTCCCCACCAC (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33986
Size: 1 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: North European, Dutch, Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Harteveld CL, Heister JG, Giordano PC, Batelaan D, von Delft P, Haak HL, Wijermans PW, Losekoot M, Bernini LF, An IVS1-116 (A-->G) acceptor splice site mutation in the alpha 2 globin gene causing alpha + thalassaemia in two Dutch families., British journal of haematology, 95(3), 461-6, 1996
  2. He XH, Zhang R, Mai GX, Ren LR, Li DZ, First Report of a Case with Nondeletional Hb H Disease Caused by IVS-I-116 (A>G) of the α2-Globin Gene., Hemoglobin, 42(0), 344-346, 2018
Created on 2010-06-16 16:13:15, Last reviewed on 2021-08-25 12:41:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.