IthaID: 36


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +10 (-T) HGVS Name: HBB:c.-41delT
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GAGCCATCTATTGCTTACATTTGCT [-/T] CTGACACAACTGTGTTCACTAGCAA (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70554
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Greeks
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Publications / Origin

  1. Athanassiadou A, Papachatzopoulou A, Zoumbos N, Maniatis GM, Gibbs R, A novel beta-thalassaemia mutation in the 5' untranslated region of the beta-globin gene., British journal of haematology, 88(2), 307-10, 1994
Created on 2010-06-16 16:13:14, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.