IthaID: 3591

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs2963155	HGVS Name:	NG_009062.1:g.64074T>C

Context nucleotide sequence:
TTAGAGAGAAGGAACGTGGACATA [T>C] AGAGGTAGCTCTAGATGGAGAAGGG (Strand: -)

Also known as:

Comments: The GG and GA genotypes associated with increased health care utilization for acute pain in an African-American cohort with sickle cell disease. No association with chronic pain as deduced by Composite Pain Index (CPI). Though there is a strong linkage disequilibrium among the three NR3C1 variants (rs33389, rs2963155 and rs9324918), they do not form a haploblock.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Pain [HP:0012531]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	5
Locus:	NG_009062.1
Locus Location:	64074
Size:	1 bp
Located at:	NR3C1
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Jhun EH, Sadhu N, Yao Y, He Y, Molokie RE, Wilkie DJ, Wang ZJ, Glucocorticoid receptor single nucleotide polymorphisms are associated with acute crisis pain in sickle cell disease., Pharmacogenomics, 19(13), 1003-1011, 2018

Created on 2020-05-19 12:27:55, Last reviewed on 2020-05-19 12:31:36 (Show full history)

A/A	Date	Curator(s)	Comments
1	2020-05-19 12:27:55	The IthaGenes Curation Team	Created
2	2020-05-19 12:31:36	The IthaGenes Curation Team	Reviewed. Paper added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.