
IthaID: 359
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor | HGVS Name: | HBA2:c.95+2_95+6delTGAGG |
| Hb Name: | N/A | Protein Info: | α2 nts 134-138 deleted |
| Also known as: | α-5nt |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTATGGTGCGGAGGCCCTGGAGAGG [-/TGAGG] CTCCCTCCCCTGCTCCGACCCGGGC (Strand: +)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33872 |
| Size: | 5 bp |
| Located at: | α2 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
| Ethnic Origin: | Mediterranean, Middle East, Dutch, Moroccan |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Orkin SH, Goff SC, Hechtman RL, Mutation in an intervening sequence splice junction in man., Proceedings of the National Academy of Sciences of the United States of America, 78(8), 5041-5, 1981
- Felber BK, Orkin SH, Hamer DH, Abnormal RNA splicing causes one form of alpha thalassemia., Cell , 29(3), 895-902, 1982
- Harteveld KL, Heister AJ, Giordano PC, Losekoot M, Bernini LF, Rapid detection of point mutations and polymorphisms of the alpha-globin genes by DGGE and SSCA., Hum. Mutat. , 7(2), 114-22, 1996
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-11-10 12:49:31 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.