IthaID: 3589
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 62-65 (-12bp) | HGVS Name: | HBB:c.187_198delGCTCATGGCAAG |
| Hb Name: | N/A | Protein Info: | p.62_65delAHGK |
Context nucleotide sequence:
ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG [-/GCTCATGGCAAG] AAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCT (Strand: -)
Also known as:
Comments: Found in a heterozygote 3-years old boy with hemolytic anaemia since birth, elevated levels of HbF and HbA2 and target cells in the blood smear. The 12bp in frame deletion leading to a deletion of four amino acids. Patient also carries a mutation in PIEZO1 (c.5195C>T). Whether the clinical picture of the patient is caused by a strong modifying effect of the new mutation in PIEZO1 or is combined effect of two strongly deleterious mutations of PIEZO1 and β-globin gene is unclear.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | Unclear |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70911 |
| Size: | 12 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Polish |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Maciak K, Adamowicz-Salach A, Siwicka A, Poznanski J, Urasinski T, Plochocka D, Gora M, Burzynska B, Hereditary xerocytosis - spectrum and clinical manifestations of variants in the PIEZO1 gene, including co-occurrence with a novel β-globin mutation., Blood Cells Mol. Dis., 80(0), 102378, 2020