IthaID: 3584


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2236599 HGVS Name: NC_000009.12:g.107487224C>T

Context nucleotide sequence:
TGAAGAAGGTGGGGTGAGCATCAT [C>T] CCGTGTGTCCCGAAGTGGGGCCAG (Strand: +)

Also known as:

Comments: SNV associated with hydroxyurea treatment efficacy in sickle cell disease/β-thalassaemia compound heterozygous patients (82 cases, 85 healthy controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 9
Locus: NM_004235.6
Locus Location: N/A
Size: 1 bp
Located at: KLF4
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Stratopoulos A, Kolliopoulou A, Karamperis K, John A, Kydonopoulou K, Esftathiou G, Sgourou A, Kourakli A, Vlachaki E, Chalkia P, Theodoridou S, Papadakis MN, Gerou S, Symeonidis A, Katsila T, Ali BR, Papachatzopoulou A, Patrinos GP, Genomic variants in members of the Krüppel-like factor gene family are associated with disease severity and hydroxyurea treatment efficacy in β-hemoglobinopathies patients., Pharmacogenomics, 20(11), 791-801, 2019
Created on 2020-04-30 19:31:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.