IthaID: 3580


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1050828 HGVS Name: NG_009015.2:g.16571G>A

Context nucleotide sequence:
GGCCTTCTGCCCGAAAACACCTTCATC [G>A] TGGGCTATGCCCGTTCCCGCCTCACAG (Strand: -)

Also known as:

Comments: SNP associated with MRA-defined cerebral vasculopathy in pediatric male patients with SCA from the Silent Infarct Transfusion (SIT) Trial (n=208). G6PD enzyme activity is decreased by about 30% when this variation is present.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: X
Locus: NG_009015.2
Locus Location: 16571
Size: 1 bp
Located at: G6PD
Specific Location: Exon 4

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Thangarajh M, Yang G, Fuchs D, Ponisio MR, McKinstry RC, Jaju A, Noetzel MJ, Casella JF, Barron-Casella E, Hooper WC, Boulet SL, Bean CJ, Pyle ME, Payne AB, Driggers J, Trau HA, Vendt BA, Rodeghier M, DeBaun MR, Magnetic resonance angiography-defined intracranial vasculopathy is associated with silent cerebral infarcts and glucose-6-phosphate dehydrogenase mutation in children with sickle cell anaemia., Br. J. Haematol., 159(3), 352-9, 2012
Created on 2020-03-25 20:20:37, Last reviewed on 2020-03-30 16:05:01 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.