IthaID: 3580
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs1050828 | HGVS Name: | NG_009015.2:g.16571G>A |
Context nucleotide sequence:
GGCCTTCTGCCCGAAAACACCTTCATC [G>A] TGGGCTATGCCCGTTCCCGCCTCACAG (Strand: -)
Also known as:
Comments: SNP associated with MRA-defined cerebral vasculopathy in pediatric male patients with SCA from the Silent Infarct Transfusion (SIT) Trial (n=208). G6PD enzyme activity is decreased by about 30% when this variation is present.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
Chromosome: | X |
---|---|
Locus: | NG_009015.2 |
Locus Location: | 16571 |
Size: | 1 bp |
Located at: | G6PD |
Specific Location: | Exon 4 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Thangarajh M, Yang G, Fuchs D, Ponisio MR, McKinstry RC, Jaju A, Noetzel MJ, Casella JF, Barron-Casella E, Hooper WC, Boulet SL, Bean CJ, Pyle ME, Payne AB, Driggers J, Trau HA, Vendt BA, Rodeghier M, DeBaun MR, Magnetic resonance angiography-defined intracranial vasculopathy is associated with silent cerebral infarcts and glucose-6-phosphate dehydrogenase mutation in children with sickle cell anaemia., Br. J. Haematol., 159(3), 352-9, 2012
Created on 2020-03-25 20:20:37,
Last reviewed on 2020-03-30 16:05:01 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-03-25 20:20:37 | The IthaGenes Curation Team | Created |
2 | 2020-03-25 20:23:29 | The IthaGenes Curation Team | Reviewed. Location added. |
3 | 2020-03-30 16:05:01 | The IthaGenes Curation Team | Reviewed. HGVS name, Allele and Context sequence corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02