IthaID: 3579
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs3115229 | HGVS Name: | NC_000004.12:g.122088578T>C |
Context nucleotide sequence:
CAGAGGGTGAAGGGCAAGTTTTCCC [T>C] TTGCCCTACAGTAGAAATTAATAAA (Strand: +)
Also known as:
Comments: SNP associated with acute, severe vaso-occlusive pain requiring hospitalization among pediatric patients with SCA (n=1293 participants in the SIT trial and CSSCD). SNP is located 63.7 kb 5' upstream of the KIAA1109 gene.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Vaso-occlusive crisis |
Location
| Chromosome: | 4 |
|---|---|
| Locus: | N/A |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | TRPC3-KIAA1109 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Chaturvedi S, Bhatnagar P, Bean CJ, Steinberg MH, Milton JN, Casella JF, Barron-Casella E, Arking DE, DeBaun MR, Genome-wide association study to identify variants associated with acute severe vaso-occlusive pain in sickle cell anemia., Blood, 130(5), 686-688, 2017
Created on 2020-03-25 15:47:40,
Last reviewed on 2020-03-25 20:27:04 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.