IthaID: 3576
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | rs10768683 | HGVS Name: | NG_000007.3:g.71055G>C |
Context nucleotide sequence:
AACTTCAGGGTGAGTCTATGGGAC [G>C] CTTGATGTTTTCTTTCCCCTTCTTTTC (Strand: -)
Also known as: IVS II-16 G>C, HBB:c.315+16G>C
Comments: Variant identifies the polymorphic site AvaII in the beta-globin gene cluster that is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian). It has been included on SNP chips to infer β-haplotypes [PMID: 18829352, 28800727, 23606168] and to develop a fetal haplotype phase strategy for the NIPD of beta-thalassaemia [PMID: 22896714]. It has been found in a heterozygous and homozygous state in a normal healthy population from urban eastern India [PMID: 24099628], as well as in Mohajir families from Pakistan [PMID: 22392582].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71055 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Indian, Pakistani |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009
- Lam KW, Jiang P, Liao GJ, Chan KC, Leung TY, Chiu RW, Lo YM, Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia., Clin. Chem. , 58(10), 1467-75, 2012
- Moatter T, Kausar T, Aban M, Ghani S, Pal JA, Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population., Int. J. Hematol. , 95(4), 394-8, 2012
- Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013
- Sahoo SS, Biswal S, Dixit M, Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population., Hemoglobin , 38(1), 33-8, 2014
- Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017