IthaID: 3575
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs968857 | HGVS Name: | NG_000007.3:g.58388A>T | NG_000007.3:g.58388A>G |
Context nucleotide sequence:
TGCCTCTGCTATAGTTTGATTAGTCA [A/G/T] CAAGCATGTGTCATGCATTTATTCAC (Strand: -)
Also known as:
Comments: Variant identifies the polymorphic site HincII in the beta-globin gene cluster, which is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 58388 |
| Size: | 1 bp |
| Located at: | HBD-HBBP1 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017
Created on 2020-03-10 15:49:47,
Last reviewed on 2020-04-22 13:55:33 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.