IthaID: 3568
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 28 GCC>-CC | HGVS Name: | HBA2:c.85delG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CACGCTGGCGAGTATGGTGCGGAG [-/G] CCCTGGAGAGGTGAGGCTCCCTCC (Strand: +)
Also known as:
Comments: Reported in a proband presenting with persistent microcytosis and hypochromia. The deletion of a nt G from codon 28 creates a shift in the reading frame with a premature stop codon at codon 48 (TGA). Residue 28 at the B helix of the α chain is part of the α1β1 interface, which plays a key role in the maintenance of the tertiary structure.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 33860 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Moroccan |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Ropero P, Arbeteta J, Nieto JM, González FA, González B, Villegas A, Benavente C, Nondeletional α-Thalassemia: Two New Mutations on the α2 Gene., Hemoglobin, 2020
Created on 2020-02-03 11:50:47,
Last reviewed on 2022-09-20 09:28:31 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-02-03 11:50:47 | The IthaGenes Curation Team | Created |
2 | 2022-08-24 09:22:56 | The IthaGenes Curation Team | Reviewed. Allele phenotype added. |
3 | 2022-09-20 09:28:31 | The IthaGenes Curation Team | Reviewed. Comment edit. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07