IthaID: 3563
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 126 GTG>-TG | HGVS Name: | HBB:c.379delG |
| Hb Name: | N/A | Protein Info: | p.Val127Cysfs*32 |
Context nucleotide sequence:
CTTTGGCAAAGAATTCACCCCACCA [-/G] TGCAGGCTGCCTATCAGAAAGTGGT (Strand: -)
Also known as:
Comments: Reported as a de novo mutation in a heterozygous carrier presenting with mild β-thalassaemia intermedia phenotype. Both his parents had normal β gene analysis. The proband had hemolytic anaemia with splenomegaly and his bone marrow showed erythroid hyperplasia and dyserythropoiesis resembling congenital dyserythropoietic anaemia (CDA). The loss of a nt G from codon 126 results in a frameshift and the elongation of the β-globin chain to 156 amino acids (157 aa is "TAA").
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | Dominant |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71953 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Turkish |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gürlek-Gökçebay D, Akpinar-Tekgunduz S, Erdem HB, Yarali N, A Heterozygous Variant (: c.379delG, p.Val127Cysfs*32) Associated with a Mild β-Thalassemia Intermedia Phenotype in a Turkish Child., Hemoglobin, 43(0), 277-279, 2019