IthaID: 3558


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-821 (A>C) HGVS Name: HBB:c.316-30A>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AAGCTAGGCCCTTTTGCTAATC [A>C] TGTTCATACCTCTTATCTTCCT (Strand: -)

Also known as:

Comments: There are conflicting interpretations of pathogenicity for this variant. Data from contributors shows that carriers presented with normal haematological indices and also that co-inheritance of IVS II-821 (A>C) with α-variants does not cause more severe clinical symptoms than expected. In contrast, the variant was found in a Kurdish family [PMID: 31146650] where three siblings were carriers and presented with low haematological indices and abnormal HbA2 (around 5%). The father and one sibling had no mutations in the β-globin gene. No maternal information was provided. Bioinformatics analysis showed that this variant may influence normal splicing process.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71860
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Kurdish, Cypriot
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Azimi A, Nejati P, Tahmasebi S, Alimoradi S, Alibakhshi R, Characterization of the IVS-II-821 (A>C) (: c.316-30A>C) Mutation in a β-Thalassemia Phenotype in Iran., Hemoglobin, 43(1), 23-26, 2019
Created on 2020-01-17 11:28:40, Last reviewed on 2022-11-15 13:16:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.