IthaID: 3555
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 124 (+C) | HGVS Name: | HBB:c.374dup |
| Hb Name: | N/A | Protein Info: | p.Pro126Thrfs*15 |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCATCACTTTGGCAAAGAATTCACCC [-/C] ACCAGTGCAGGCTGCCTATCAGAAAG (Strand: -)
Comments: Single nucleotide duplication (+C) generating a frameshift that leads to shortening of the β-globin chain with a stop codon at codon 139 (TAA). Reported in a patient with severe microcytic and hypochromic anaemia.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71948 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Algerian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Abdaoui W, Benouareth DE, Djenouni A, Renoux C, Grifi F, Gouri A, Athamnia F, Benalioua M, Joly P, Genetic Background of β-Thalassemia in Northeast Algeria with Assessment of the Thalassemia Severity Score and Description of a new β-Thalassemia Frameshift Mutation (: c.374dup; p.Pro126Thrfs*15)., Hemoglobin, 43(0), 223-228, 2019
Created on 2020-01-10 08:59:43,
Last reviewed on 2020-07-01 11:47:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.