IthaID: 3546
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 130 TAT>-AT | HGVS Name: | HBD:c.391delT |
| Hb Name: | Hb A2-Gaslini 1 | Protein Info: | p.Tyr131Ilefs? |
Context nucleotide sequence:
AATTCACCCCACAAATGCAGGCTGCC [T/-] ATCAGAAGGTGGTGGCTGGTGTGGCT (Strand: -)
Also known as:
Comments: Single nucleotide deletion (-T) generating a frameshift with elongation of the δ-globin chain to 212 amino acids. Found in a heterozygous state. Presents with normochromic normocytic red cell morphology, HbA2 level 1.6% and HbF level 0.6%. No visible peak on HPLC, hence presumed to be unstable.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | δ-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 64599 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Mahmud N, Maffei M, Mogni M, Forni GL, Pinto VM, Barberio G, Ungari S, Maffè A, Curcio C, Zanolli F, Paventa R, Carta M, Caleffi A, Mercadanti M, Maoggi S, Ivaldi G, Coviello D, Hemoglobin A and Heterogeneous Diagnostic Relevance Observed in Eight New Variants of the Delta Globin Gene., Genes (Basel), 12(11), 0, 2021
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Coviello, Domenico | 2019-12-12 | First report. |
| 2 | Maffei, Massimo | 2019-12-12 | First report. |
Created on 2019-12-16 16:26:15,
Last reviewed on 2023-03-13 15:17:19 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.