IthaID: 3540


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1482813291 HGVS Name: NC_000010.11:g.70151276_70151284del

Context nucleotide sequence:
TTCATACCAAAAAAAAAAAAAAAA [-/AAAAAAAAA] CCTGGAAAAGCTACAGATGTTAACC (Strand: +)

Also known as:

Comments: Variant showed significant association with total haemoglobin levels after hydroxyurea treatment in SCD patients. Source: Blood (2019) 134 (Supplement_1): 987; doi.org/10.1182/blood-2019-124965.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Response to hydroxyurea

Location

Chromosome: 10
Locus: NM_001142648.2
Locus Location: N/A
Size: 9 bp
Located at: SAR1A
Specific Location: 3'UTR 0

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: N/A
DNA Sequence Determined: No

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2019-12-12 15:08:51, Last reviewed on 2019-12-12 15:41:22 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.