IthaID: 3539
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs115340990 | HGVS Name: | NC_000010.11:g.70151008A>G |
Context nucleotide sequence:
TCTCCAATCTGTTCATAGGAGAT [A>G] TATCTTTTGATCTTTTATTATAAG (Strand: +)
Also known as:
Comments: SNP showed significant association with total haemoglobin levels after hydroxyurea treatment in SCD patients. SNP generates an miRNA-binding site within the 3'UTR of SAR1A gene (e.g., mirR-1270, miR-4784, miR-3171, miR-1206, miR-1273f, miR-620, miR-143-3p). Source: Blood (2019) 134 (Supplement_1): 987; doi.org/10.1182/blood-2019-124965.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Response to hydroxyurea |
Location
| Chromosome: | 10 |
|---|---|
| Locus: | NM_001142648.2 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | SAR1A |
| Specific Location: | 3'UTR 0 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | N/A |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2019-12-12 14:18:20,
Last reviewed on 2019-12-12 15:40:54 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.