
IthaID: 3533
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs56303718 | HGVS Name: | NC_000010.11:g.70170898C>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CACTTGAGGTGGATCCCTCCAAG [C>A] TTTTGCTTTTTTTCTTCCTTGCTTTT (Strand: +)
Comments: SNP is located within 2KB 5' of SAR1A gene. SNP is associated with a higher percent of HbF with hydroxyurea (HU) treatment (69 cases,107 controls) and with a significant change in absolute HbF levels after 2 years of HU treatment (n=32) in African Americans with sickle cell disease (SCD) acquired from the Sickle Cell Pulmonary Hypertension Screening Study. SNP did not associate with baseline HbF or HU-induced HbF levels in SCD patients from Cameroon (n=484). Note: Published SNP position 'chr10:71600660 (hg18)' is remapped on the GRCh38.p13 genome assembly.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F response to hydroxyurea |
Location
Chromosome: | 10 |
---|---|
Locus: | NM_001142648.2 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | SAR1A |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African-American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008
- Pule GD, Bitoungui VJN, Chemegni BC, Kengne AP, Wonkam A, SAR1a promoter polymorphisms are not associated with fetal hemoglobin in patients with sickle cell disease from Cameroon., BMC Res Notes , 10(1), 183, 2017