IthaID: 3532

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs56291099 HGVS Name: NC_000010.11:g.70171322G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTATTGTGCACTTATGTTCCA [G>A] GCAGAGCACTGGGTACTTTGC (Strand: +)

Comments: SNP is located within 2KB 5' of SAR1A gene. SNP is associated with a higher percent of HbF with hydroxyurea (HU) treatment (69 cases,107 controls) and with a significant change in absolute HbF levels after 2 years of HU treatment (n=32) in African Americans with sickle cell disease (SCD) acquired from the Sickle Cell Pulmonary Hypertension Screening Study. SNP did not associate with baseline HbF or HU-induced HbF levels in SCD patients from Cameroon (n=484). Note: Published SNP position 'chr10:71601084 (hg18)' is remapped on the GRCh38.p13 genome assembly.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 10
Locus: NM_001142648.2
Locus Location: N/A
Size: 1 bp
Located at: SAR1A
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African-American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008
  2. Pule GD, Bitoungui VJN, Chemegni BC, Kengne AP, Wonkam A, SAR1a promoter polymorphisms are not associated with fetal hemoglobin in patients with sickle cell disease from Cameroon., BMC Res Notes , 10(1), 183, 2017
Created on 2019-12-12 12:08:33, Last reviewed on 2019-12-12 15:35:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.