IthaID: 3532
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs56291099 | HGVS Name: | NC_000010.11:g.70171322G>A |
Context nucleotide sequence:
TTTATTGTGCACTTATGTTCCA [G>A] GCAGAGCACTGGGTACTTTGC (Strand: +)
Also known as:
Comments: SNP is located within 2KB 5' of SAR1A gene. SNP is associated with a higher percent of HbF with hydroxyurea (HU) treatment (69 cases,107 controls) and with a significant change in absolute HbF levels after 2 years of HU treatment (n=32) in African Americans with sickle cell disease (SCD) acquired from the Sickle Cell Pulmonary Hypertension Screening Study. SNP did not associate with baseline HbF or HU-induced HbF levels in SCD patients from Cameroon (n=484). Note: Published SNP position 'chr10:71601084 (hg18)' is remapped on the GRCh38.p13 genome assembly.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F response to hydroxyurea |
Location
| Chromosome: | 10 |
|---|---|
| Locus: | NM_001142648.2 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | SAR1A |
| Specific Location: | N/A 0 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008
- Pule GD, Bitoungui VJN, Chemegni BC, Kengne AP, Wonkam A, SAR1a promoter polymorphisms are not associated with fetal hemoglobin in patients with sickle cell disease from Cameroon., BMC Res Notes , 10(1), 183, 2017