IthaID: 3516

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2218660 HGVS Name: NC_000002.12:g.46120653T>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCAGATGTAGATGATGTAGGCTTTTT [T>G] AACTCTTCTGAAGATAGGAGAAGGC (Strand: +)

Comments: SNP associated with haematological parameters (e.g., lower levels of haemoglobin and haematocrit and a lower red blood cell count) in the Kore Association Resource (KARE) project of the Korean Genome Epidemiology Study (KoGES; n=8842). The association was replicated in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667) [PMID: 26064965].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Abnormal Hb [HP:0011902]
Abnormal haematocrit [HP:0031850]
Abnormal red blood cell count [HP:0020058]

Location

Chromosome: 2
Locus: NM_005400.3
Locus Location: N/A
Size: 1 bp
Located at: PRKCE
Specific Location: Intron 11

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Korean
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Kim YK, Oh JH, Kim YJ, Hwang MY, Moon S, Low SK, Takahashi A, Matsuda K, Kubo M, Lee J, Kim BJ, Influence of Genetic Variants in EGF and Other Genes on Hematological Traits in Korean Populations by a Genome-Wide Approach., Biomed Res Int , 2015(0), 914965, 2015
Created on 2019-12-05 15:41:15, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.