IthaID: 3513


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 8 AAG>AA- HGVS Name: HBB:c.27delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGTGCATCTGACTCCTGAGGAGAA [G/-] TCTGCCGTTACTGCCCTGTGGGGCA (Strand: -)

Also known as:

Comments: Found as a de novo mutation in a compound heterozygous state with Hb E in a transfusion-dependent 1-year-old child presenting with β-thalassaemia major complications. The mother was a heterozygous carrier of Hb E and the father was evaluated as normal. Paternity was confirmed. The loss of a nt G from codon 8 changes the reading frame with a stop codon at codon 18 resulting in a premature termination of translation.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70621
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Bangladeshi
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Hasan KN, Sufian A, Mazumder AK, Khaleque MA, Rahman M, Akhteruzzaman S, A Novel Pathogenic β-Thalassemia Mutation Identified at Codon 8 (: c.27delG) in a Bangladeshi Family Acquired ., Hemoglobin, 43(3), 162-165, 2019
Created on 2019-12-03 09:15:28, Last reviewed on 2019-12-03 16:37:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.