IthaID: 3512


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2872817 HGVS Name: NG_028264.1:g.39392A>G

Context nucleotide sequence:
AGTTTTTTCAATGTATTTCCTTC [A>G] TGAGTAAAGAAAATGTGGATT (Strand: +)

Also known as:

Comments: SNP associated with episodes of pain in patients from the Cooperative Study of Sickle Cell Disease (CSSCD, n=1514). The association was not replicated in a second, independent group of patients from the CSSCD (n=387).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Location

Chromosome: X
Locus: NG_028264.1
Locus Location: 39392
Size: 1 bp
Located at: TKTL1
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African-American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Galarneau G, Coady S, Garrett ME, Jeffries N, Puggal M, Paltoo D, Soldano K, Guasch A, Ashley-Koch AE, Telen MJ, Kutlar A, Lettre G, Papanicolaou GJ, Gene-centric association study of acute chest syndrome and painful crisis in sickle cell disease patients., Blood , 122(3), 434-42, 2013
Created on 2019-11-29 12:15:47, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.