IthaID: 3502
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs13113915 | HGVS Name: | NC_000004.12:g.186544810G>A |
Context nucleotide sequence:
GGGGAGAAATGCGCCAGCAGCGTCTA [G>A] GACAACACCTCTGAAAGACAGAGGATG (Strand: -)
Also known as:
Comments: SNP associated with painful crisis in patients from the Cooperative Study of Sickle Cell Disease (CSSCD, n=1514). The association was not replicated in a second, independent group of patients from the CSSCD (n=387).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pain [HP:0012531] |
Location
| Chromosome: | 4 |
|---|---|
| Locus: | NM_005958.4 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | MTNR1A |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Galarneau G, Coady S, Garrett ME, Jeffries N, Puggal M, Paltoo D, Soldano K, Guasch A, Ashley-Koch AE, Telen MJ, Kutlar A, Lettre G, Papanicolaou GJ, Gene-centric association study of acute chest syndrome and painful crisis in sickle cell disease patients., Blood , 122(3), 434-42, 2013
Created on 2019-11-26 17:09:33,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.