IthaID: 349
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 14 TGG>TAG [Trp>STOP] | HGVS Name: | HBA1:c.44G>A |
Hb Name: | N/A | Protein Info: | α1 14(A12) Trp>Stop |
Context nucleotide sequence:
GACAAGACCAACGTCAAGGCCGCCT [G>A] GGGTAAGGTCGGCGCGCACGCTGGC (Strand: +)
Protein sequence:
MVLSPADKTNVKAAX
Also known as:
Comments: Reported in a heterozygous state in two independent carriers, one person of Lak ethnicity from Lorestan province (MCV 78 fL, MCH 29.4 pg, HbA2 2.8%) and in a cord blood sample from Hormozgan province (Hb 9 g/dL, MCV 85 fL, MCH 27.4 pg, Hb Barts 6.1%).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37623 |
Size: | 1 bp |
Located at: | α1 |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Nonsense codon (Translation) |
Ethnic Origin: | Iranian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Frequencies
Publications / Origin
- Harteveld CL, Yavarian M, Zorai A, Quakkelaar ED, van Delft P, Giordano PC, Molecular spectrum of alpha-thalassemia in the Iranian population of Hormozgan: three novel point mutation defects., American journal of hematology, 74(2), 99-103, 2003
- Moradi K, Aznab M, Tahmasebi S, Dastafkan Z, Omidniakan L, Ahmadi M, Alibakhshi R, The Spectrum of α-Thalassemia Mutations in the Lak Population of Iran., Hemoglobin, 43(2), 107-111, 2019
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-02-28 08:20:11 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-08 17:13:42 | The IthaGenes Curation Team | Reviewed. |
4 | 2020-08-10 15:11:54 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. Protein info and Comment added. |
5 | 2020-08-10 15:16:19 | The IthaGenes Curation Team | Reviewed. Reference added. |
6 | 2022-02-28 08:20:11 | The IthaGenes Curation Team | Reviewed. Allele phenotype corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45