IthaID: 3465
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2445284 | HGVS Name: | NC_000011.10:g.5008473C>T |
Context nucleotide sequence:
CACACACAAACATTAGCTTACTCTTTCTTA [C>T] ACTATGAATTAATAACAAGATATTTTAAAA (Strand: +)
Also known as:
Comments: SNP associated with haemolysis in sickle cell anaemia in samples taken from the CSSCD (n=1117), Walk-PHaSST (n=449) and PUSH (n=296) studies.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | OR51L1-OR51P1P |
| Specific Location: | N/A 0 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Milton JN, Rooks H, Drasar E, McCabe EL, Baldwin CT, Melista E, Gordeuk VR, Nouraie M, Kato GR, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Rana S, Castro O, Zhang Y, Thein SL, Sebastiani P, Gladwin MT, , Steinberg MH, Genetic determinants of haemolysis in sickle cell anaemia., Br. J. Haematol. , 161(2), 270-8, 2013
Created on 2019-09-30 10:26:39,
Last reviewed on 2019-12-13 10:10:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.