IthaID: 3444
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 147 TAA>TCA [Stop>Ser] | HGVS Name: | HBB:c.443A>C |
| Hb Name: | Hb Kanagawa | Protein Info: | N/A |
Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCACT [A>C] AGCTCGCTTTCTTGCTGTCCAATT (Strand: -)
Also known as:
Comments: Reported as a de novo mutation in a two-month-old patient, initially diagnosed with congenital dyserythropoietic anaemia. This mutation results in a stop-codon substitution to a serine residue and an increase of 21 amino-acids in the beta-globin chain. Leads to a dominant beta-thalassemia state according to this case report.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Dominant |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72017 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Nonsense codon (Translation) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Sugiyama M, Hamanoue S, Nagai JI, Tsurusaki Y, Kurosawa K, Tanaka M, Tanaka Y, Goto H, Hemoglobin beta Kanagawa [c.443A>C; p.(Ter148Serext*21)]: A novel β-globin gene mutation causing dominantly inherited β-thalassemia., Pediatr Blood Cancer, 66(9), e27871, 2019
Created on 2019-09-03 12:49:58,
Last reviewed on 2023-07-03 16:00:59 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.