IthaID: 3443

Context nucleotide sequence:
GGGATATTATGAAGGGCCTTGAGCATC [T>C] GGATTCTGCCTAATAAAAAACATTTATT (Strand: -)

Also known as:

Comments: The mutation is located 12 nucleotides upstream of the polyadenylation signal in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype, while in compound heterozygosity with severe beta-thal mutations, it leads to a beta-thal intermedia state.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Cai SP, Eng B, Francombe WH, Olivieri NF, Kendall AG, Waye JS, Chui DH, Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene., Blood, 79(5), 1342-6, 1992
2. Divoky V, Baysal E, Oner R, Cürük MA, Walker EL, Indrak K, Huisman TH, The T-->C mutation at position +96 of the untranslated region 3' to the terminating codon of the beta-globin gene is a rare polymorphism that does not cause a beta-thalassemia as previously ascribed., Hum. Genet., 93(1), 77-8, 1994
3. Bilgen T, Canatan D, Arıkan Y, Yeşilipek A, Keser İ, The effect of HBB: c.*+96T>C (3'UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype., Turk J Haematol, 28(3), 219-22, 2011
4. Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Di Maggio R, Renda D, Maggio A, Giambona A, Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia., Int J Lab Hematol, 38(1), 17-26, 2016
5. Theodoridou S, Vyzantiadis TA, Vlachaki E, Compound Heterozygosity for Silent Cap +1570 (T>C) (HBB: c*96T>C), Codon 39 (C>T) (HBB: c.118C>T) and the Presence of ααα/αα in Greece. A Case Presentation., Hemoglobin, 42(3), 194-195, 2018