IthaID: 3443


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: Cap +1570 (T>C) HGVS Name: HBB:c.*96T>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGGATATTATGAAGGGCCTTGAGCATC [T>C] GGATTCTGCCTAATAAAAAACATTTATT (Strand: -)

Also known as:

Comments: The mutation is located 12 nucleotides upstream of the polyadenylation signal in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype, while in compound heterozygosity with severe beta-thal mutations, it leads to a beta-thal intermedia state.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72114
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Czech, Greek, Turkish, Italian, Irish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Cai SP, Eng B, Francombe WH, Olivieri NF, Kendall AG, Waye JS, Chui DH, Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene., Blood, 79(5), 1342-6, 1992
  2. Divoky V, Baysal E, Oner R, Cürük MA, Walker EL, Indrak K, Huisman TH, The T-->C mutation at position +96 of the untranslated region 3' to the terminating codon of the beta-globin gene is a rare polymorphism that does not cause a beta-thalassemia as previously ascribed., Hum. Genet., 93(1), 77-8, 1994
  3. Bilgen T, Canatan D, Arıkan Y, Yeşilipek A, Keser İ, The effect of HBB: c.*+96T>C (3'UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype., Turk J Haematol, 28(3), 219-22, 2011
  4. Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Di Maggio R, Renda D, Maggio A, Giambona A, Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia., Int J Lab Hematol, 38(1), 17-26, 2016
  5. Theodoridou S, Vyzantiadis TA, Vlachaki E, Compound Heterozygosity for Silent Cap +1570 (T>C) (HBB: c*96T>C), Codon 39 (C>T) (HBB: c.118C>T) and the Presence of ααα/αα in Greece. A Case Presentation., Hemoglobin, 42(3), 194-195, 2018
Created on 2019-09-03 12:13:12, Last reviewed on 2024-04-18 10:10:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.