IthaID: 3443

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGGATATTATGAAGGGCCTTGAGCATC [T>C] GGATTCTGCCTAATAAAAAACATTTATT (Strand: -)

Comments: The mutation is located 12 nucleotides upstream of the polyadenylation signal in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype, while in compound heterozygosity with severe beta-thal mutations, it leads to a beta-thal intermedia state.

Heterozygous records (preview in IthaPhen)

1. Cai SP, Eng B, Francombe WH, Olivieri NF, Kendall AG, Waye JS, Chui DH, Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene., Blood, 79(5), 1342-6, 1992
2. Divoky V, Baysal E, Oner R, Cürük MA, Walker EL, Indrak K, Huisman TH, The T-->C mutation at position +96 of the untranslated region 3' to the terminating codon of the beta-globin gene is a rare polymorphism that does not cause a beta-thalassemia as previously ascribed., Hum. Genet., 93(1), 77-8, 1994
3. Bilgen T, Canatan D, Arıkan Y, Yeşilipek A, Keser İ, The effect of HBB: c.*+96T>C (3'UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype., Turk J Haematol, 28(3), 219-22, 2011
4. Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Di Maggio R, Renda D, Maggio A, Giambona A, Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia., Int J Lab Hematol, 38(1), 17-26, 2016
5. Theodoridou S, Vyzantiadis TA, Vlachaki E, Compound Heterozygosity for Silent Cap +1570 (T>C) (HBB: c*96T>C), Codon 39 (C>T) (HBB: c.118C>T) and the Presence of ααα/αα in Greece. A Case Presentation., Hemoglobin, 42(3), 194-195, 2018