IthaID: 3442


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 51-58 (+24 bp) HGVS Name: HBA1:c.157_180dupTCTGCCCAGGTTAAGGGCCACGGC
Hb Name: Hb Choisy Protein Info: N/A

Context nucleotide sequence:
CCCGCACTTCGACCTGAGCCACGGC [-/TCTGCCCAGGTTAAGGGCCACGGC] AAGAAGGTGGCCGACGCGCTGACCA (Strand: +)

Also known as:

Comments: Insertion of eight amino acids (Ser-Ala-Gln-Val-Lys-Gly-His-Gly) due to a 24 bp duplication from nucleotide 157 to 180. The His(E7) residue appears to be in its normal position, while the eight additional residues are probably inserted at the beginning of helix E, increasing its size, but with mild effects on folding and heme contact.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37853
Size: 24 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Wajcman H, de Brevern AG, Riou J, Latouche C, Marden MC, Pissard S, Short in-Frame Insertions/Deletions in the Coding Sequence of the α-Globin Gene. Consequences of the 3D Structure and Resulting Phenotypes: Hb Choisy as an Example., Hemoglobin, 42(0), 287-293, 2018
Created on 2019-08-01 16:08:22, Last reviewed on 2019-08-01 16:09:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.