IthaID: 3437
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 2 CAT>-AT | HGVS Name: | HBB:c.7delC |
| Hb Name: | Hb Bundelkhand | Protein Info: | N/A |
Context nucleotide sequence:
CACTAGCAACCTCAAACAGACACCATGGTG [C>T] ATCTGACTCCTGAGGAGAAGTCTGCCGTTA (Strand: -)
Also known as:
Comments: Reported in a heterozygous state with mild anaemia, as well as in co-inheritance with a β+ mutation with severe anaemia. This deletion is predicted to result in the shifting of reading frame and hence premature termination of the polypeptide after codon 3. The abnormal mRNA is presumably degraded before traduction by the NMD mechanism.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β0 |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70601 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2019-06-24 15:26:39,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.