IthaID: 343
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Init CD ATG>A-G | HGVS Name: | HBA2:c.2delT |
| Hb Name: | N/A | Protein Info: | α2 Initiation codon Met->0 |
Context nucleotide sequence:
CCACAGACTCAGAGAGAACCCACCA [-/T] GGTGCTGTCTCCTGCCGACAAGACC (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33777 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Initiation codon (Translation) |
| Ethnic Origin: | Vietnamese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Waye JS, Eng B, Patterson M, Chui DH, Nisbet-Brown E, Olivieri NF, Novel mutation of the alpha 2-globin gene initiation codon (ATG-->A-G) in a Vietnamese girl with Hb H disease., Hemoglobin, 21(5), 469-72, 1997
- Viprakasit V, Chinchang W, Glomglao W, Tanphaichitr VS, A rare association of alphaO-thalassemia (--SEA) and an initiation codon mutation (ATG-->A-G) of the alpha2 gene causes Hb H disease in Thailand., Hemoglobin , 29(3), 235-40, 2005
Created on 2010-06-16 16:13:15,
Last reviewed on 2014-05-19 09:25:58 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.