IthaID: 3422


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1320959 HGVS Name: NC_000006.12:g.135116248T>C

Context nucleotide sequence:
AGAATAACATTAATTAGAAAATAAAAAACA [T>C] TGTAAGTAGAGAAAGAGGCCCTAGAAGAAA (Strand: +)

Also known as:

Comments: SNP associated with HbF levels in β-thalassaemia heterozygotes from Hong Kong.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. So CC, Song YQ, Tsang ST, Tang LF, Chan AY, Ma ES, Chan LC, The HBS1L-MYB intergenic region on chromosome 6q23 is a quantitative trait locus controlling fetal haemoglobin level in carriers of beta-thalassaemia., J. Med. Genet. , 45(11), 745-51, 2008
Created on 2019-05-27 16:13:18, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.