IthaID: 342

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Init CD ATG>ACG [Met>Thr] HGVS Name: HBA2:c.2T>C
Hb Name: N/A Protein Info: α2 Initiation codon Met>Thr
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCACAGACTCAGAGAGAACCCACCA [C/T] GGTGCTGTCTCCTGCCGACAAGACC (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33777
Size: 1 bp
Located at: α2
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Initiation codon (Translation)
Ethnic Origin: Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Pirastu M, Saglio G, Chang JC, Cao A, Kan YW, Initiation codon mutation as a cause of alpha thalassemia., The Journal of biological chemistry, 259(20), 12315-7, 1984
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 17:09:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.