
IthaID: 342
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Init CD ATG>ACG [Met>Thr] | HGVS Name: | HBA2:c.2T>C |
| Hb Name: | N/A | Protein Info: | α2 Initiation codon Met>Thr |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCACAGACTCAGAGAGAACCCACCA [C/T] GGTGCTGTCTCCTGCCGACAAGACC (Strand: +)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33777 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Initiation codon (Translation) |
| Ethnic Origin: | Mediterranean |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Pirastu M, Saglio G, Chang JC, Cao A, Kan YW, Initiation codon mutation as a cause of alpha thalassemia., The Journal of biological chemistry, 259(20), 12315-7, 1984
Created on 2010-06-16 16:13:15,
Last reviewed on 2014-04-08 17:09:16 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.